E tanulmány az égerfák fitoftórás betegségével kapcsolatos nemzetközi és hazai eredményeket foglalja össze. Az 1990-es évek közepén, Dél-Angliában felfedezett égervész Európa számos országában, így Ma

A Phytoptora-fajhibridek, mint az égervész kórokozói

Érsek Tibor, Bakonyi József és Nagy Zoltán Árpád
Hirdetés

Iratkozz fel Te is Youtube csatornánkra, kattints az alábbi YOUTUBE ikonra! 

 

 

E tanulmány az égerfák fitoftórás betegségével kapcsolatos nemzetközi és hazai eredményeket foglalja össze. Az 1990-es évek közepén, Dél-Angliában felfedezett égervész Európa számos országában, így Magyarországon is megjelent, más földrészen való elôfordulása azonban nem ismert. Brit kutatók bizonyítékai szerint a kórokozó a P. cambivora és a P. fragariae vagy fragariae-szerû faj természetes úton kialakult fajhibridje. Az újabban P. alniként számon tartott fajhibridegyüttes agresszivitási, morfológiai, továbbá citológiai és molekuláris tulajdonságaikban jelentôsen eltérô típusokat (alfajokat) foglal magában. Mint ilyenek, új típusú kihívást jelentenek a növénykórtani kutatásban és gyakorlatban egyaránt, már csak azért is, mert a környezet természetellenes változásaival tovább fokozódhat a hibridizációs események gyakorisága, ami még a jelenleginél is súlyosabb növényvédelmi és -egészségügyi problémákat vethet fel. Hatékony védekezési stratégia kialakítása elképzelhetetlen megfelelô diagnosztika nélkül, hiszen a hagyományos, fôként morfológiára alapozó módszerekkel szinte lehetetlen meghatározni a különbözô hibridtípusokat. E felismerés ösztönözte azt a kutatást, amelynek során a szerzôk egy olyan, a polimeráz-láncreakción alapuló molekuláris markerrendszert dolgoztak ki, ami lehetôvé teszi a P. alni hibridtípusainak gyors és differenciált kimutatását a kórokozó tenyészetébôl és fertôzött növényi szövetbôl egyaránt.
A Phytoptora-fajhibridek, mint az égervész kórokozói, a Növényvédelem cikke, égerfitoftóra

A fajok fennmaradását a genetikai kód állandósága biztosítja. Az a tény viszont, hogy a természet ennek ellenére, illetve emellett kialakította és alakítja a maga szabad szemmel is észrevehetô küllemi (fenotípusos) sokszínûségét, a genetikai anyag módosulásaira utal. A genetikai változások különbözô mutációs folyamatok, valamint ivaros és ivartalan (paraszexuális vagy szomatikus) kölcsönhatások révén valósulnak meg, amelyekben mind a kromoszomális, mind az extrakromoszomális DNS-ek szerepet játszhatnak, és speciális allélek új kombinációját alakíthatják ki. Meghatározó jelentôsége van a változatosság kialakításában a populáció egyedei közötti genetikai információ egyirányú vagy kölcsönös átadásának, majd rekombinációjának, az ún. intraspecifikus (a faj egyedei közötti) genetikai kölcsönhatásnak.


Általánosan is, de e dolgozatban kizárólag a Phytophthora-fajokra (Oomycetes: gombaszerû petespórás szervezetekre) szûkítve kimondható, hogy a molekuláris módszerek térhódításával vált bizonyítottá az a korábban csak feltételezett jelenség (Brasier 1992): interspecifikus rekombináció is lehetséges, és ennek eredményeként életképes fajhibridek keletkezhetnek. Vagyis az intraspecifikus kölcsönhatás mellett a rokon fajok egyedei között megvalósuló, interspecifikus hibridizáció szintén hozzájárulhat egy nemzetség sokszínûségének, ill. új minôségû populációknak a kialakításához.

Az szintén felvetôdött, hogy ha létezik is fajok között rekombináció, akkor az csak igen kis gyakorisággal következhet be a természetben. A ritka természeti jelenség tényét látszik igazolni egyrészt az, hogy a feltárt fajhibridek száma összesen is alig néhányra tehetô a petespórás szervezetek, valamint a tömlôs és bazídiumos gombák körében, másrészt pedig az a tapasztalat, hogy még mesterséges úton (in vitro vagy in planta) sem könnyû indukálni két faj hibridizációját. A fajok ugyanis, éppen a faji keveredés elkerülése végett, vagyis a faji jelleg megtartására hatékony gátakat fejlesztettek ki. Az eddigi eredmények tükrében valószínûsíthetô, hogy a földrajzilag elkülönülô – egyébként rokon – fajok híján vannak az ilyen gátaknak. Elméletileg megnô tehát az interspecifikus hibridizáció lehetôsége, amikor egy másutt honos faj olyan új és esetleg természetellenes környezetbe kerül, amely az ôshonos, vagy a máshonnan korábban behurcolt rokon faj(ok)nak szintén élettérként szolgál.


A fajhibridek létére egy-két évtizeddel ezelôtt – a csupán morfológiai bélyegekre alapozó vizsgálatok révén – nemigen derülhetett volna fény, így ezek nagy valószínûséggel új fajokként kerültek volna a tudományos köztudatba.
A molekuláris módszerek térhódítása kellett ahhoz, hogy egy-egy gyanús, az adott környezetben, ill. nemzetségben elôforduló valamennyi ismert fajtól eltérô, egyúttal valamelyik(ek)hez hasonló szervezetrôl bebizonyosodjék a hibrid jelleg.


Phytophthora-fajok körében a fajhibridek kialakulásának lehetôségét elôször éppen munkacsoportunk bizonyította, a zoospórák laboratóriumban indukált fúziója révén (Érsek és mtsai 1993, 1995, 1997, English és mtsai 1999, Bakonyi és mtsai 2002). Mások in vitro vizsgálatai az ivaros hibridizáció indukálhatóságát igazolták (Goodwin és Fry 1994, May és mtsai 2003). Néhány év elteltével pedig természetes úton kialakult fitoftóra-fajhibridek megjelenésérôl is értesülhetett a szakmai közvélemény.


Hidroponikus dísznövénykultúrák (Man in’t Veld és mtsai 1998, Bonants és munkatársai 2000), majd pedig az égerfák (Brasier és mtsai 1999) pusztulását kiváltó fitoftórákról derült ki a fajhibridjelleg, amely egyben a szülôkéhez képest új gazdanövényre való specializálódással párosult.


A következôkben az eddig azonosított egyetlen, természetben létrejött Phytophthorafajhibridrôl, az égerfitoftóráról rendelkezésünkre álló ismeretanyagot foglaljuk össze.


Az égervész hibrid kórokozója

A New Scientist 1999-es májusi számában megjelent, meghökkentô címû szerkesztôségi cikk az európai égereseket veszélyeztetô „ördögi gomba ámokfutására” hívta fel a figyelmet.
Mint ahogy az valamivel korábbi tudományos közleményekben is olvasható, a pusztítást elôször a 90-es évek elsô felében észlelték Dél-Angliában és Walesben. A gyökfô közelében kialakuló kéregelhalás, de különösen a törzsön mutatkozó kátrányfoltosodás tünetei, majd a kórokozó morfológiai bélyegei alapján a szakemberek a Phytophthora cambivorára gyanakodtak (Brasier és mtsai 1995).


Kiderült azonban: az új kórokozó, a hasonlóságok ellenére, sok tekintetben különbözik a P.cambivorától. Abban hasonló, hogy izolátumainak többsége szemölcsös-rücskös falú nôi ivarszerveket (oogóniumokat) képez, és hogy hímivarszerveik (az anterídiumok) kétsejtûek, és körülölelik az oogóniumnyelet (amfigin típusúak).
De ellentétben a P. cambivorával, amely heterotallikus, vagyis ivaros folyamatához két, ellentétes párosodási típusú telep (egyed) kölcsönhatása szükséges, az égerfitoftóra homotallikus, azaz egy telepen belül zajlik az ivaros ciklusa.


Mindemellett eltérôek növekedésük hômérséklet-optimumai és -maximumai, de gazdakörük sem egyezik (1. táblázat). Igaz, hogy a P. cambivora fôleg a különbözô fafajok kórokozója, az égert azonban nem betegíti. Ezzel szemben az új kórokozónak az égeren kívül más gazdanövénye nem ismert. Eme megkülönböztetô bélyegek alapján tehát az égerfitoftórát akár új fajként is leírhatták volna.
Amikor az égerfitoftórát összehasonlító DNS-vizsgálatoknak vetették alá, a riboszomális DNS ITS- (internal transcribed spacer) szekvenciái, valamint a teljes genomi DNS polimeráz-láncreakcióval (PCR-rel) felszaporított szakaszainak méretkülönbözôségei (AFLP: amplified fragment length polymorphisms) alapján megállapították, hogy a kórokozó nem más, mint egy természetben létrejött, igen képlékeny, nagy változékonyságú fajhibrid (Brasier és mtsai 1999). Genomjában kétséget kizáróan, más módszerekkel is kimutathatók az égerre
nem patogén P. cambivorára és P. fragariaera jellemzô DNS-szekvenciák (Brasier és mtsai 1999, Nagy és mtsai 2003).

Az éger-Phytophthora és szülőfajai citológiai, valamint tenyészetbeli tulajdonságai


Az elsô jelzéseket követôen Európa több országban, így Svédországban, Német- és Franciaországban, valamint Hollandiában, Belgiumban és Ausztriában (cf., Brasier 1999), újabban pedig Olasz- (Santini és mtsai 2001) és Csehországban (Cˇerny´ és mtsai 2003) is megtalálták a kórokozót, amely Franciaországban és Bajorországban például még a Nagy-Britanniában észlelteknél is nagyobb károkat okoz (Streito és mtsai 2002, Jung és Blaschke 2004). Kiderült továbbá: a hibrid korántsem olyan egységes, mint ahogy az kezdetben tûnt; sok-sok izolátum jellemzése alapján két nagy csoportja különböztethetô meg. Az egyikbe az általánosan elterjedt, igen agresszív, ún. standard típus, a másikba pedig a ritkábban elôforduló, kevésbé agresszív, ún. variánsok tartoznak. A variánsok különbözô típusait származási helyük alapján nevezték el; így van svéd, ill. az annál még ritkábban elôforduló holland, német és brit (UK) változat (Brasier és mtsai 1999). Ezek közül egyedül a svéd variánsnak nem szemölcsösek, hanem sima felületûek az oogóniumai (1. ábra). Említésre méltó azonban az a saját megfigyeléseken alapuló tény, hogy tenyészetben növekedési optimumnál alacsonyabb (~16–20 °C) hômérsékleten az oogóniumok nagy részének felülete a svéd variáns esetében enyhén szemölcsössé, a standard típuséban pedig simává válik (Nagy és mtsai 2003, ill. nem közölt adatok).

Az égervész hibrid kórokozója, a Phytophthora alni oospóráinak fény- és pásztázó elektronmikroszkópos képe


Magyarországon – ahol az erdôterületek kb. 3%-át (50 ezer hektár) teszik ki az égeresek (fôleg a mézgás éger [Alnus glutinosa]) –, elôször egy hansági erdôségben soproni kutatók figyeltek fel az újszerû betegségre (Varga 2000). Az onnan származó izolátumok elemzése a svéd típusúval egyezô variáns elôfordulását jelezte (Szabó és mtsai 2000, Nagy és mtsai 2000, 2003). Késôbb Hévíz környékén a standard típus (Nagy és mtsai 2002, 2003), a Nógrád megyei Királyréten pedig mindkét alfaj felbukkant (Bakonyi és mtsai 2006). Mindazonáltal Koltay (2003) tünetek alapján történô felvételezései arra utalnak, a kórokozó általánosan elterjedt az ország különbözô égereseiben, mind a nagyobb részt ültetvényszerûen telepített síkvidéki lápi égeresekben, mind a kisebb területet kitevô hegyvidéki, patak menti állományokban. A kétféle állomány fertôzöttsége hasonló; az átlagos fertôzöttség 1–5%, de egyes helyeken elérheti a 30–60%-ot is.


E hibridkomplexumot nemrégiben Brasier és munkatársai (2004) faji (P. alni) státusba helyezték, és a különbözô típusokat alfajokként (subspecies: ssp.) határozták meg. A standard típusnak a P. alni ssp. alni, a szintén elég egységesnek tûnô svéd variánsnak a P. alni ssp. uniformis nevet adták, a morfológiailag meglehetôsen heterogén holland, a német és a brit variánsok csoportját pedig P. alni ssp. multiformisként jelölték. Az egyes alfajok jelentékenyen különböznek egymástól AFLP-, RAPD- (random amplified polymorphic DNA), ITS-restrikciós, mtDNS-restrikciós, valamint glükóz-foszfát izomeráz és malát dehidrogenáz mintázataikban, alfajokon belül azonban nincsenek ilyen jellegû molekuláris eltérések, még az esetleges morfológiai változatosság ellenére sem (Nagy és mtsai 2003, Brasier és mtsai 2004). Ploídia tekintetében e hibridek aneuploidok, azaz a
nemzetségre jellemzô kromoszóma-alapszámtól (2n) több kromoszómával eltérnek, más szóval: távol vannak a stabilitást jelentô diploid állapottól (1. táblázat).

Hirdetés


Legstabilabbnak a csaknem négyszeres kromoszómaállományú (tetraploid) standard típus (P. alni ssp. alni) tûnik, amely sokkal súlyosabb tüneteket vált ki, mint a variánsok.
Mindezek ismeretében talán nem tûnik túlzó megállapításnak, hogy a számos ökológiai és gazdasági tényezôre visszavezethetô fajhibridképzôdés új kihívást jelent a kutatásban és a gyakorlatban egyaránt. Kártételük megelôzéséhez és az ellenük való hatékony fellépéshez mindenekelôtt gyors és megbízható kimutatási módszerek szükségesek.

Az égerfitoftóra izolálása

 


Szerencsére lényegesen könnyebb tiszta tenyészetet nyerni az olyan kéregszövetbôl, amelyen már egyértelmûen látszik a betegségtünet.
Csakhogy több évet is igénybe vehet az, hogy e talajlakó mikroszervezet a gyökérzetet megtámadva, azon keresztül a föld feletti részbe jusson, és kialakítsa a törzs torzulásos és kátrányfoltos tüneteit (Nagy és mtsai 2003).


Mivel az égervész terjedésében meghatározó szerepet játszik az új telepítésû csemeték eleve fertôzött volta (Jung és Blaschke 2004), kívánatos volna a kórokozó kimutatása és ezzel a fertôzött egyedek kiszûrése már a faiskolai állományban, a tünetek megjelenése elôtt. Ehhez viszont a gyökérzetet is tartalmazó talajkörnyezetbôl (a rhizoszférából) való izolálás szükséges.
Ennek többé-kevésbé hatékony módszere a csapdázás. Lényege az, hogy a kirajzásukhoz nem steril(!) talajkivonatot igénylô zoospórák behatolnak a talajmintát borító víz felszínére helyezett rhododendron- vagy babérmeggylevélbe (Themann és Werres 1998, Nagy és mtsai 2003), amelyen a fertôzés eredményeként vízzel átitatott léziók alakulnak ki. Ezekbôl a levélfoltokból már sokkal könnyebb a kórokozót tiszta tenyészetbe vinni, mint közvetlenül a sokféle mikroorganizmust tartalmazó talajmintából.


Mivel azonban az égeres talajkörnyezetben más, hasonló módon csapdázható fitoftórák (P. cambivora, P. cactorum, P. citricola, P. gonapodyides, P. inundata, P. quercina) is bôven elôfordulnak (Bakonyi és mtsai 2003, Brasier 1999, Brasier és mtsai 2003a, 2003b), a levélcsapdából kitenyésztett telepeket morfológiai bélyegeken alapuló azonosításnak (is) célszerû alávetni. Ez hosszadalmas, mindazonáltal nagy szakértelmet kívánó eljárás.
A P. alni tenyészetben tudniillik nem egykönnyen hozza létre a morfológiai meghatározáshoz szükséges ivartalan és ivaros képleteit.
A telepek sporangiumképzése és a sporangiumok rajzóspóra-kibocsátása (az ivartalan ciklus) például csak nem csírátlanított talajszûrletben indukálhatók, az ivaros képletek pedig csak bizonyos táptalajokon (sárgarépaagar, esetleg borsóagar), a növekedéshez optimális hômérsékletnél néhány fokkal alacsonyabb (a P. alni ssp. uniformis 22–23 °C) vagy éppen magasabb (a P. alni ssp. alni 27–28 °C) hômérsékleten képzôdnek tömegesen (Érsek és mtsai, nem közölt adatok). Továbbá, mint az elôzôekben említettük, a hômérséklet befolyásolhatja az oogóniumok morfológiai tulajdonságait is.

P. alni-specifikus PCR-markerek

 


Elsôként munkacsoportunk tervezett e kórokozó kimutatására, ill. alfajainak differenciált azonosítására molekuláris diagnosztikai eljárást (Érsek és mtsai 2003, Bakonyi és mtsai 2004).
Mielôtt azonban a kutatás teljes anyaga publikálásra került volna, DeMerlier és mtsai (2005) is beszámoltak hasonló eredményrôl azzal a különbséggel, hogy a belga munkacsoport által kifejlesztett marker az alfajok megkülönböztetésére nem képes. A két munkában közös elem, hogy a specifikus RAPD szakasz terminális bázissorrendje alapján származtatott indítószekvencia (primer)-párral a PCR egyetlen, specifikusan egyedi terméket szaporít fel a kórokozó tiszta tenyészetébôl kivont DNS igen kis (az eljárástól függôen 10–50 pikogrammnyi) mennyiségébôl.

A SAP és a SWAP indítószekvencia-párok származása és az általuk felszaporított P. alni-specifikus PCR-termékek


Az általunk kidolgozott markerrendszer lényege a következôkben foglalható össze (2. táblázat). A P. alni ssp. alni (standard) típusizolátumából az OPG-02 indítószekvenciával nyert (de a holland, valamint német variánsokra is jellemzô) 0,93 kb hosszúságú RAPD-fragmentum terminális szekvenciái alapján terveztetett a SAP (Standard Alder [éger] Phytophthora) primerpár, amely szekvenciái tartalmazzák (aláhúzott rész) az OPG-02 primer teljes szekvenciáját is: SAP1: 5’–GGCACTGAGGGTTCCTC–3’ és SAP2: 5’–GGCACTGAGGTCTAGATT–3’.
A P. alni ssp. uniformis (svéd variáns) referenciaizolátumából az OPK-12 indítószekvenciával felszaporodó (de a standardra is jellemzô) 1,13 kb hosszúságú RAPD-fragmentum terminális szekvenciái alapján született a SWAP (Swedish Alder Phytophthora) primerpár, amely tartalmazza (aláhúzott rész) az OPK-12 teljes szekvenciáját is:

A Phytophthora alni kimutatása és azonosítása a SAP, ill. SWAP specifikus indítószekvencia párokkal

SWAP1: 5’–TGGCCCTCACATTAAAACTGCTGC–3’ és SWAP2: 5’-TGGCCCTCACCAAATGCGAAATGA–3’. Ezek az indítószekvencia-párok – ellentétben az egyszerre többféle és döntô többségében nem specifikus DNS-szakaszt is felszaporító RAPD-primerekkel – már szigorúan csak egyetlen, a megfelelô RAPD-produktummal erôsen homológ és azonos nagyságú terméket szaporítottak fel a PCR során. A SAP-primerek a P. alni ssp. alni (standard) és a P. alni ssp. multiformis (holland és német variáns) izolátumaira, a SWAP-primerek pedig P. alni ssp. uniformis (svéd variáns) mellett a P. alni ssp. alni (standard) izolátumaira bizonyultak specifikusnak (2. táblázat); 31 egyéb fitoftóra és néhány egyéb gombaszerû szervezet és valódi gomba összesen mintegy 100 izolátumából ugyanis semmiféle PCR-terméket nem lehetett kimutatni, még ezerszeres templátmennyiségbôl sem!

Az égervész molekuláris diagnosztikája

 


Bármennyire megbízhatóak is ezek a tiszta tenyészetekkel kapott eredmények, egy diagnosztikai laboratóriumban akkor hasznosulhatnak igazán, ha a módszer alkalmazható a kórokozónak a fertôzött növénybôl való, közvetett kimutatására is, vagyis ha még az izolálással sem kell bajlódni.


Az ilyen irányú vizsgálatokhoz kapóra jött a Sigma-Aldrich cég REDExtract-N-Amp™ Plant PCR csomagja; ez tartalmaz minden olyan reagenst (egyebek közt PCR-inhibitorokat semlegesítô anyagokat), amellyel az extrakciós pufferrel kivont DNS közvetlenül alkalmazható PCR-re (lásd: Sigma-terméktájékoztató). További elônye ennek a gyorsan és egyszerûen kivitelezhetô eljárásnak, hogy nincs szükség a minta mélyfagyasztására, mechanikus roncsolására, a hagyományosan – pl. a fitoftóra miceliális DNS-ének kivonására is – használt és az egészségre káros fenol/kloroform alkalmazására, és mellôzi a DNS-tisztítási lépéseket. Nem utolsósorban, az egyébként levelek DNS-ének kivonására és felszaporítására ajánlott módszer kitûnôen alkalmazható magának a fitoftóra-DNS-nek növényi mintából való a kimutatására, nem csak levélbôl (talajmintából való csapdázásra használt babérmeggylevélbôl), hanem kéregszövetbôl, sôt a kórokozó zoospóráiból is (Bakonyi és mtsai 2006).
A módszer diagnosztikai célokra való alkalmazhatóságának illusztrálására nézzünk néhány kísérletesen alátámasztott eredményt részletesebben!
Az égeres talajból való csapdázást követôen a babérmeggyleveleken kifejlôdött léziókból kivont DNS-bôl legtöbb esetben felszaporítható valamelyik P. alni-specifikus amplikon. Elôfordul ellenben az is, hogy nincs PCR-termék; ilyen esetekben azonban a léziókból csak valamilyen más fitoftórafaj (pl. a P. citricola vagy a P. gonapodyides) tenyészthetô ki, a P. alni soha (Bakonyi és mtsai 2003, 2006).


Egy, az égervész tüneteit mutató fa kéregszövetmintájából, majd az abból izolált kórokozó zoospóra-szuszpenziójából a SAP1/SAP2 indítószekvencia-pár a 0,93 kb, a SWAP1/SWAP2 pedig az 1,13 kb nagyságú egyedi DNS-szakaszt szaporította fel; ennek alapján a betegséget egyértelmûen a P. alni ssp. alni (a standard típus) okozta (2. ábra). Egy másik fának a betegségtüneteit viszont kétséget kizáróan a P. alni ssp. uniformis (a svéd variáns) váltotta ki, mivel kéregmintából csupán a SWAP1/SWAP2 primerek termelték a megfelelô amplikont.
Annak ellenére, hogy a REDExtract-NAmp™ Plant PCR csomagot a növényi DNS vizsgálatára dolgozták ki, remekül használható növénymentes fitoftórás rendszerben is. Bakonyinak és munkatársainak (2006) erre az új megállapítására legkézenfekvôbb bizonyíték, hogy már 10(!) zoospóra elegendô ahhoz, hogy a SAP vagy SWAP primerek kimutatható mennyiségben felszaporítsák a P. alni-specifikus DNS-szakaszokat (2. ábra). Ismerve a P. sojae és a P. infestans diploid genomjának sejtmagvankénti tömegét, ami 0,208, illetve 0,52 pikogramm (Rutherford és Ward 1985, Tooley és Therrien 1987), könnyen kiszámítható, hogy 20, illetve 50 nukleusz megközelítôen 10 pg DNS-t tartalmaz. Ha feltételezzük a P alni e két faj bármelyikével való hasonlóságát, akkor a közel tetraploid P. alni esetében kevesebb, azaz mintegy 10–25 sejtmagnak lehet 10 pg-nyi genomtömege.


Az a tény, hogy a zoospórák egymagvúak, és hogy 10 zoospóra elegendô templát- DNS-sel szolgál a PCR-es felszaporításhoz, arra utal, hogy az e módszerrel nyert zoospóra-DNS kimutathatósági határa 10 pg vagy még annál is kevesebb. (Emlékeztetôül: a közkeletû módszerekkel elôkészített miceliális DNS kimutatása legalább 20–50 pg templátot igényel!)

Hirdetés


Nagy érzékenységük révén ezek a markerek és az alkalmazott módszer tehát alkalmasak az égervész kórokozójának néhány óra alatt elvégezhetô kimutatására és azonosítására tiszta tenyészetbôl vagy nem steril talajkivonatban képzôdô zoospórákból, de akár közvetlenül a kórokozó által kolonizált növényi szövetbôl, akár az éger talajkörnyezetében elôforduló fitoftórafajok közül közvetve – levélcsapdákból.
Érdekességként megemlítendô, hogy a P. alni saját (nem közölt) vizsgálataink alapján felszaporítható egy olyan primerpárral is, amelyet Schubert és munkatársai (1999) a P. cambivora (NB. az égerfitoftóra egyik szülôfaja) specifikus PCR-es azonosítására dolgoztak ki – még mielôtt az égerfitoftóra bekerült volna a tudományos köztudatba. Amellett, hogy ez az adat további adalék a két kórokozó igen szoros genetikai rokonságához, egyben figyelmeztetô is, hogy egy-egy molekuláris marker specifikussága nem abszolutizálható.

Az interspecifikus hibridizáció jelentôsége és hatásai

 


Mivel manapság a korábbiakhoz mérten szokatlan feltételek gyakrabban föllépnek – a természet rendjét megváltoztató emberi beavatkozás révén is –, nagyobb valószínûséggel kerülhetnek növények és kórokozóik olyan körülmények közé, amik lényegesen fölgyorsíthatják az ilyen jellegû evolúciós jelenségeket. Gibbs és mtsai (1999) szoros összefüggést találtak például a folyó menti égererdôk fitoftórás pusztulásának
mértéke és a víz oxidált nitrogénvegyületekkel való szennyezettsége között.
Az égerfitoftóra kártételére az 1990-es évek elején figyeltek fel elôször a dél-angliai tôzeglápos erdôkben, ahova a betegség észlelését megelôzô években a kontinentális Európából importáltak facsemetéket a folyópartok megerôsítésére.


Brit szakemberek (Brasier és mtsai 1999) feltételezése szerint az exportáló országok valamelyikében mehetett végbe a két szülôfaj hibridizációja, és a hibrid kórokozó onnan került a csemetékkel Nagy-Britanniába. Pontosan nem tudjuk, mennyi idôt vett igénybe ez az evolúciós folyamat, és melyik ország lehetett az égervész „bölcsôje”, és azt sem, milyen úton terjedt földrészünkön, és hogyan került hazánkba.


Elképzelhetô, hogy a hibridizáció nagyjából egyidejûleg, több helyen is végbement, és a hibrid kórokozó további evolúciója egyes országokban eltérôen zajlott (gondoljunk a különbözô variánsokra!). Nem könnyû feladat még annak megállapítása sem, hogy egyes országokban mikor jelent meg a kórokozó, hiszen a betegségtünetek jóval a kórozó megjelenése után fejlôdnek ki. Bár a betegséget itthon 1999-ben észlelték elôször, a megbetegedett fák torzult törzsi keresztmetszete, pontosabban: az ép rész kitüremkedésében az évgyûrûk száma arról árulkodik, hogy a kórokozó már 1994–95 elôtt jelen volt az országban (Nagy és mtsai 2002).


E hibridek fennmaradását valószínûleg a növényi maradványokat átszövô micélium biztosítja, ugyanis az áttelelésre általában alkalmasabb oospórák túlélô képessége – legalábbis a vizsgált standard típusban és laboratóriumi körülmények között – igen kicsi, ami a terjesztésben való csekély szerepüket valószínûsíti (Delcan és Brasier 2001). Megfigyelések utalnak arra, hogy kis területen belül a kórokozó elsôsorban zoospórákkal, esetleg micéliummal átszôtt növényi maradványokkal terjed. Ebben a víznek jelentôs közvetítô szerepe lehet, mert például a folyó (patak) menti égeresekben a betegség sokkal gyakrabban jelentkezik a vízhez közel álló, mint az attól távolabb lévô fákon (Gibbs és mtsai 1999). Ellenben a kórokozó nagy távolságú, országokon is átívelô terjesztésében minden bizonnyal az eleve fertôzött faiskolai állományból széttelepített csemeték viszik a fôszerepet.


Túlélésre valószínûleg úgy van leginkább esélyük e fajhibrideknek, ha életerôsebbek és agresszívebbek a szülôfajoknál és/vagy azokéhoz képest gazdakörük is bôvül. A P. alninál ez utóbbi úgy következhetett be, hogy az egymástól korábban elszigetelten élô szülôfajai hirtelen közös és számukra természetellenes területre/növényre kerültek anélkül, hogy kifejleszthették volna a genetikai kölcsönhatásokat kizáró mechanikai-biokémiai gátakat. Mind a P. cambivora, mind a P. fragariae behurcolt kórokozónak számít Európában, hibridizációjuk pedig valószínûleg a málnán mint közös gazdanövényen ment végbe, és a hibrid szervezet patogenitása olyan növényre (az égerre) hangolódott, amelyet a szülôk egyike sem képes betegíteni (Brasier és mtsai 1999).

Az égerfitoftóra faji státusba emelése kissé elhamarkodottnak tûnik, hiszen különbözô típusai (alfajai) messze állnak a Phytophthorafajokra jellemzô diploid állapottól. Ezért egyelôre talány, mennyire életképesek ezek a fajhibridek, hogy egyáltalán stabilizálódott-e már annyira a genomjuk, hogy új fajokként követeljenek helyet maguknak a természetben, vagy kialakulatlanságuk miatt eltûnnek egy idô után. Brasier és munkatársai (1999) arra következtetnek, hogy az ismert variánsok a standard típusból rekombináció és kromoszómavesztés következtében alakultak ki, illetve jelenleg is alakulnak. Sôt úgy tûnik, más típusú (eleddig nem azonosított) variánsok evolúciója is folyamatban van (Jung és Blaschke 2004). Mi több, munkacsoportunk rátalált olyan égerfitoftórára, amelyet PCR-primereink egyértelmûen standard típusként (P. alni ssp. alniként) azonosítottak, mtDNS-ének restrikciós mintázata azonban nem a P. alni ssp. alniéval, hanem svéd variánséval (P. alni ssp. uniformiséval) egyezett (Bakonyi és mtsai, nem közölt adatok). Ez a további vizsgálatokat igénylô eredmény felveti egy olyan kölcsönhatásnak a lehetôségét a két hibridtípus között, amelynek eredményeként kialakul egy új típusú egyed a P. alni ssp. alni sejtmagjával és a P. alni ssp. uniformis mitokondriumaival.

Az ilyen és ehhez hasonló evolúciós folyamatok jelentôs zavarokat okozhatnak a növényegészségügyi intézkedésekben. Mivel az égervész Európán kívül más kontinensen még nem bukkant fel, általános szakmai érdek ezt a földrajzi izolációt fenntartani. Szükséges tehát egy olyan védekezési stratégia kidolgozása, amely erdei ökoszisztémákban is alkalmazható. Mindenekelôtt arról kellene gondoskodni, hogy az új telepítésekre szánt égercsemeték mentesek legyenek a kórokozótól. Mivel a rezisztenciára nemesítés hosszadalmas feladat, egyelôre a faiskolai állományok szûrôvizsgálata látszik megoldhatónak. Egy ilyen program végrehajtásához azonban gyors és megbízható diagnosztikai eljárások szükségesek. Munkánkkal e feladat sikeréhez kívántunk hozzájárulni.

 

Érsek Tibor, Bakonyi József és Nagy Zoltán Árpád
MTA Növényvédelmi Kutatóintézete, 1525 Budapest, Pf. 102.

Növényvédelem 41 (11), 2005

Mint súlyos gazdasági problémákat magában rejtô s ezzel új kihívásokat jelentô természeti jelenségrôl, az interspecifikus hibridizációról meglehetôsen kevés ma még az ismeretünk (cf., Érsek 2000, 2002; Schardl és Craven 2003).
Hajlamosak vagyunk azt hinni, hogy a fajhibridek az igencsak felgyorsult nemzetközi kereskedelem és a természet rendjébe való minduntalan beavatkozás következményeként a jelen kor szülöttei, hiszen lényegében csupán az utóbbi tíz évben hallunk róluk. Herbáriumi anyagok molekuláris biológiai vizsgálatából azonban kitûnik, hogy pl. a nyárfarozsda fajhibridjei már legalább egy évszázaddal ezelôtt elôfordultak az USA-ban, sôt jelen voltak olyan területeken is, amelyek kívül estek a szülôfajok tipikus élôhelyein, csak legfeljebb nem okoztak a maihoz fogható mértékû károkat (Newcombe és mtsai 2000).
Figyelembe véve az eddigieket, kitûnik, hogy a P. alnira kifejlesztett markerrendszer alkalmas az egyes alfajok differenciált kimutatására és azonosítására – legalábbis tenyészetbôl.
Lássunk néhány közelebbi példát! Ha egy meghatározandó égerfitoftóra-izolátumból a SAPprimerek adnak terméket (amplikont), de a SWAP-primerek nem, akkor az adott izolátum a P. alni ssp. multiformist képviseli. Amikor viszont csak a SWAP produkál terméket és a SAP nem, akkor a P. alni ssp. uniformisszal (svéd variánssal) állunk szemben. Végül az az izolátum, amelybôl mindkét primerpár felszaporítja a maga termékét, nem lehet más, mint a standard típus, vagyis a P. alni ssp. alni.
A kórokozó hagyományos, fôként morfológiai bélyegekre épülô meghatározásakor jelentkezô nehézségeket ma már a molekuláris diagnosztika adta lehetôségek kiküszöbölhetik. Különösképpen a PCR-en alapuló módszerek kínálnak gyors és nagy biztonsággal végezhetô megoldást a kórokozó azonosítására, akár még a fertôzött növénybôl is, ha sikerül más kórokozókban nem lévô, specifikus DNS-szekvenciaszakaszokat feltárni. Ilyen, a P. alnira specifikus szakaszok kiszûrhetôk például a tetszôlegesen választott indítószekvenciával felszaporított számos DNS-szakasz (RAPD-) gélmintázatából (Nagy és mtsai 2003).
Meglehetôsen körülményes a többségükben talajlakó fitoftóráknak, így az égerfitoftórának is az izolálása talajkörnyezetükbôl. Márpedig ha nem sikerül kitenyészteni a kórokozót, a morfológiai alapon történô meghatározás sem lehetséges.

Forrás: Növényvédelem

Ha tetszett ez a cikk, oszd meg ismerőseiddel, kattints ide:

MEGOSZTÁS MEGOSZTÁS MEGOSZTÁS MEGOSZTÁS

Ezek is érdekelhetnek

Hirdetés

Párnafa

A párnafa a teraszdeszkák alatt, azokra merőlegesen futó alátétszerkezeti elem. Nagyban... Tovább

67/2007. (VII. 26.) FVM rendelet

az Európai Mezõgazdasági Vidékfejlesztési Alapból a fiatal mezõgazdasági termelõk számára... Tovább

Tovább a lexikonra
Hirdetés
IRATKOZZ FEL A HÍRLEVELÜNKRE!X
Érdekelnek a legfrisebb iparági hírek, legújabb blogbejegyzéseink?


A 'FELIRATKOZOM A HÍRLEVÉLRE' gomb megnyomásával hozzájárulást adsz a hírlevelek fogadásához és elfogadod az Adatvédelmi Szabályzatunkat.